Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter
نویسندگان
چکیده
منابع مشابه
Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter.
The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encod...
متن کاملthe study of aaag repeat polymorphism in promoter of errg gene and its association with the risk of breast cancer in isfahan region
چکیده: سرطان پستان دومین عامل مرگ مرتبط با سرطان در خانم ها است. از آنجا که سرطان پستان یک تومور وابسته به هورمون است، می تواند توسط وضعیت هورمون های استروئیدی شامل استروژن و پروژسترون تنظیم شود. استروژن نقش مهمی در توسعه و پیشرفت سرطان پستان ایفا می کند و تاثیر خود را روی بیان ژن های هدف از طریق گیرنده های استروژن اعمال می کند. اما گروه دیگری از گیرنده های هسته ای به نام گیرنده های مرتبط به ا...
15 صفحه اولa synchronic and diachronic approach to the change route of address terms in the two recent centuries of persian language
terms of address as an important linguistics items provide valuable information about the interlocutors, their relationship and their circumstances. this study was done to investigate the change route of persian address terms in the two recent centuries including three historical periods of qajar, pahlavi and after the islamic revolution. data were extracted from a corpus consisting 24 novels w...
15 صفحه اولIsolation and characterization of the gene encoding mouse tax-responsive element-binding protein (TREB) 5.
TREB5/hXBP-1/HTF is a basic region leucine zipper protein which binds to a cyclic AMP responsive element (CRE)-like element in both human T-cell leukemia virus type 1 and human major histocompatibility complex (MHC) class II genes. To analyze the structure and transcription regulation of the TREB5 gene, we isolated the mouse TREB5 gene and cDNA. The mouse TREB5 gene contains five exons and four...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
ژورنال
عنوان ژورنال: Nucleic Acids Research
سال: 1999
ISSN: 1362-4962
DOI: 10.1093/nar/27.24.4807